sndB [2018-02-13T15:42:29.000Z]

sulphur compound N-deacetylase, the yxeK-snaB-yxeM-yxeN-yxeO-sndB-yxeQ operon may be implicated in the utilization of a modified cysteine variant

Locus: BSU39470

Isoelectric point: 5.32

Molecular weight: 41.44 kDa

Protein length: 380 aa

Gene length: 1140 bp

Function: unknown

Product: sulphur compound N-deacetylase

Essential: no

Synonyms: yxeP

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Additional metabolic pathways → Sulfur metabolism → Conversion of S-(2-succino)cysteine to cysteine
• Metabolism → Detoxification reactions

Gene

Coordinates: 4,056,870 → 4,058,012

Phenotypes of a mutant

• a sndA sndB sndC triple mutant does not grow with N-acetyl cysteine PubMed

The protein

Protein family

• peptidase M20 family (according to Swiss-Prot)

Paralogous protein(s)

• SndA(50%), SndC(38,8%), YkuR, AmhX

Structure

• 1YSJ

Expression and Regulation

Operons

• Genes: yxeK-snaB-yxeM-yxeN-yxeO-sndB-yxeQ
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • CymR: repression, PubMed, in CymR regulon

  Regulation

  • repressed in the presence of cysteine (CymR) PubMed

  Additional information

  • the amount of the mRNA is substantially decreased upon depletion of RNase Y PubMed

Biological materials

Mutant

• MGNA-B712 (yxeP::erm), available at the NBRP B. subtilis, Japan
• BKE39470 (ΔsndB::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_GTCGGCCATTGTTCTTCTCC, downstream forward: _UP4_GTTATTGTATTGGAGACCAT
• BKK39470 (ΔsndB::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_GTCGGCCATTGTTCTTCTCC, downstream forward: _UP4_GTTATTGTATTGGAGACCAT

References

Loading